Analogous and Homologous Traits

                                    Analogous Traits

Analogous structures in Biology are structures that share a similar form and function but have different origins. Analogous structures developed separately from similar selection pressures as opposed to being from common descent.  An example of an analogous structure is the patagium [P], or membrane that allows certain gliding species to glide.  The Sugar glider of Australia and Flying Squirrel of North America both possess this gliding structure. 

Flying Squirrel

The North American flying squirrel is a small, arboreal rodent found throughout northern United States and Canada.  It is nocturnal and omnivorous. Their known predators list includes hawks, owls, snakes, martens, weasels, coyotes and even domestic cats. Their survival strategies include their alertness, being active at night, and their agility in the trees.  This agility includes flight, or gliding to be more accurate.

Sugar Glider

The Australian Sugar Glider, by contrast, is a small arboreal marsupial that is indigenous to Australia and its surrounding islands.  They are omnivorous and nocturnal. They are prey animals to owls, snakes, kookaburras, foxes, and feral cats. They survive by being alert, being active at night and their agility in the trees. They sound like almost the same animal as the flying squirrel. But they are not closely related. Their common feature, the patagium, is an example of analogous adaptation.

Australia began to separate from Godwanda at the beginning of the age of mammals some 55 Mya. Long before this special adaptation could have been shared. 

 

The Sugar Glider is not even a squirrel at all. It’s actually a type of possum, a marsupial or monotreme. They raise their young in pouches like kangaroos and have a mildly prehensile tail like other possums.  The Flying Squirrel is a rodent and a placental mammal. 

The geographical separation dictates that their most common ancestor must have been prior to this continental shift. This assertion is supported by their genetic differences and other physical traits. The common ancestor of the Sugar Glider and Flying Squirrel did not possess a Patagium but this trait was such an advantage that it developed separately at least twice.  Their striking similarity is a testament to the universal exploitation of a pragmatic solution. Which is just to say, this “flying tree-rat” thing has really taken off.  

Homologous Traits

Homologous structures are structures that share similarities because the species in question share a common ancestor. While the challenge in analogy is to find a conspicuous similarity and demonstrate separate origin, the challenge in homology is the inverse. So I ask you what similarity could there be between and man and a bullfrog? Incredibly enough as different as these two species are, they share a striking number of homologous features. Bilateral symmetry, skeletal morphology, and tetrapody to name just a few. Their anatomical similarities are so great that basic courses in biology often use the dissection of these amphibians to teach basic internal anatomy. However some of their most surprising homologies are not in their anatomy but in their physiology.

Bullfrog

The Bullfrog is an aquatic amphibian that lives over most of North America. They nocturnal predators that ambush their prey. They will eat just about anything they can get in their mouth including insects, mice, fish, snakes and smaller frogs. Males are highly territorial and will aggressively guard their area. Females are slightly larger than males.

Typical adult male Human with juveniles.

Humans are terrestrial mammal and wide spread throughout the entire world tropical and temperate zones. They are omnivorous and highly territorial. They are by far the most successful and numerous of the great apes. They are bipedal, with a large cranial capacity and possess a grasping hand with a true opposing thumb.  Their bipedalism allows them to exploit the full use of their grasping hands. This coupled with their intelligence has allowed them to fill just about every available ecological niche. They will also eat just about anything they can fit in their mouths. 

As stated earlier the similarity of physiology of the frog and the human is remarkable especially when you consider their temporal separation. A frog’s cardio-pulmonary system is almost identical to that of a human. Their blood is circulated by the use of a chambered heart. The frog’s heart is 3 chambered and a human has four but the circulation is nearly identical. Blood flows from a pre-load chamber to a primary pumping chamber, atria to ventricle, then pumped to the lungs for oxygenation. The blood is oxygenated by the same physiology as in humans. The blood is exposed to the oxygen through a capillary membrane at the alveolus, and absorbed with the assistance of hemoglobin in the red blood cells.  

This is again identical to humans but for the minor difference that a frog’s red blood cell are nucleated and humans are not. This is likely because we are endotherms and our oxygen demand is much greater than that of frogs and other ectotherms. The de-nucleated allows for greater oxygen carrying capacity. This appears to be an adaptation of our inherited system.

Nucleated Frog Red Blood cells

Human Red Blood cells

 
Following circulation through the lungs the oxygenated blood is sent back to the hearts left atrium and pumped into the ventricle. From here the blood is pumped systemically through an aorta, arteries, arterioles and then to capillaries. The blood oxygenates the tissues and makes its way back via venous return. All of this is the same as human anatomy and physiology.

Actual Frog EKG

Even the electro-physiology of the cardiac cycle is the same. This means that you can do an electrocardiogram (EKG) on a frog and the rhythm is in essence identical.           

Because both the bullfrog and human share this cardio-pulmonary circulation it is obviously a very ancient oxygenation strategy.  A common ancestor for such an ancient system is hard to know but it was likely an early type of dipnoi or lung fish. The fishes have similar blood circulation minus the pulmonary component.  Lungfish are adapted to survive in pools that dried up occasionally. They have a modified swim bladder that can absorb oxygen. This is believed to be the precursor of a pulmonary system.

While lungfish are quite rare today there are seven families of fossil lungfish known. Only two survived into the Triassic (and still exist today). Though Neoceratodus is found only in Australia, fossils of that genus and the related Ceratodus have been found almost worldwide in Mesozoic strata. This indicates that they once had a much wider distribution. These lungfish were the harbingers of the tetrapods and quite likely the early pioneers in this whole pulmonary circulation strategy. This pulmonary circulation may have begun as an adaptation that allowed some fish to survive dry periods, but this variation ultimately allowed for animals through adaptive radiation to conquer a huge untapped terrestrial realm. 

While every living thing can ultimately be traced back to a common ancestor, not every anatomical structure is a direct homology.  Pragmatism appear to rule the day in the natural realm.  When a system works and performs its function it gives that organism an interim survival advantage. The organism doesn’t have the option to scrap a system and engineer a redesign. Incremental improvement on existing structures is the only option. Despite this restriction structures that are useful in one ecological niche are likely useful in a similar niche elsewhere. A “really good solution” to a problem is just that, a “really good solution.” That means it conveys a survival advantage.  We probably shouldn’t be surprised that similar really good solutions (i.e. analogous structures) recur when separated geographically or temporally, given sufficient the time for selection pressure to act.  If necessity is the mother of invention, there is no greater necessity than survival.

Here is my DNA post for the assignment of Protein Synthesis – Week 2

ACCCCTTACAACGCCGAAAACGCTAGTAACGCTGAAAACGCCATCTGAAGC

Please no mutations.